Skip to main content

Table 1 Primers used in this study

From: Efficient isolation of specific genomic regions retaining molecular interactions by the iChIP system using recombinant exogenous DNA-binding proteins

Number Name Sequence (5′ → 3′) Experiments
26572 LexA-N2 ttctctatcgataggtacctcg Real-time PCR in Figures 3, 4 and Additional file 1: Figure S1 (LexA BE)
27428 LexA-C-for-Pax5 cgctgcgtggtcgagcgtactg Real-time PCR in Figures 3, 4 and Additional file 1: Figure S1 (LexA BE)
27134 cPax5-ChIP-UP(−0.2 k)-F gggctcttatttcgtttttcttgtt Real-time PCR in Figures 3 and 4 (−0.7 k)
27135 cPax5-ChIP-UP(−0.2 k)-R gtgcttatttgtcagcgtggttg Real-time PCR in Figures 3 and 4 (−0.7 k)
27013 cPax5-ChIP-UP(−10 k)-F tccacatcgttacattgtcacttct Real-time PCR in Figures 3, 4 and Additional file 1: Figure S1 (−10 k)
27014 cPax5-ChIP-UP(−10 k)-R taaaagccctcagttcgatttattg Real-time PCR in Figures 3, 4 and Additional file 1: Figure S1 (−10 k)
26552 cPax5-inExon1A-F cctaaaacgtttagtttcagctcagt RT-PCR in Figure 5 and Additional file 1: Figure S2 (cPax5 Ex1A)
26553 cPax5-inExon1A-R ttcgtggctctctcaggtca RT-PCR in Figure 5 and Additional file 1: Figure S2 (cPax5 Ex1A)
27571 cAID-Ex3-F catgtggaggttctcttcctacg RT-PCR in Figure 5 and Additional file 1: Figure S2 (cAID Ex3)
27572 cAID-Ex3-R caagtttgggtaggcacgaag RT-PCR in Figure 5 and Additional file 1: Figure S2 (cAID Ex3)
26773 18SrRNA-F2 cttagagggacaagtggcg RT-PCR in Additional file 1: Figure S2 (18S)
26774 18SrRNA-R2 acgctgagccagtcagtgta RT-PCR in Additional file 1: Figure S2 (18S)
27420 hHS5-TAL-Target-F ccagtttctccagtttccctttt Real-time PCR in Additional file 1: Figure S5 (5′HS5)
27421 hHS5-TAL-Target-R ttttcaaaatgcaaggtgatgtc Real-time PCR in Additional file 1: Figure S5 (5′HS5)
27310 hIRF1-prom-F cgcctgcgttcgggagatatac Real-time PCR in Additional file 1: Figure S5 (IRF-1)
27312 hIRF1-prom-R1 + 2 ctgtcctctcactccgccttgt Real-time PCR in Additional file 1: Figure S5 (IRF-1)